Journal: Frontiers in Oncology

Article Title: Stromal Galectin-1 Promotes Colorectal Cancer Cancer-Initiating Cell Features and Disease Dissemination Through SOX9 and β-Catenin: Development of Niche-Based Biomarkers

doi: 10.3389/fonc.2021.716055

Figure Lengend Snippet: Fibroblast-secreted galectin-1 (Gal-1) significantly promotes multiple CIC features in CRC cells. (A) Expression of endogenous Gal-1 in MRC-5 and WS1 fibroblasts as detected through Western blot (top panel; recombinant human Gal-1 protein (rhGal-1) used as positive control) and ELISA (bottom panel). (B) Invasion capacity of KM12C with the addition of increasing doses of rhGal-1. (C) qPCR analysis for the gene expression of Twist1 and E-cadherin and (D) Western blot for protein expression of Slug and E-cadherin in KM12C with the addition of increasing doses of rhGal-1. (E) IF staining of E-cadherin (green fluorescence) in KM12C with the addition of increasing doses of rhGal-1 for 48 hours. Nuclei were stained with Hoechst 33342 (blue fluorescence); scale bar, 10 μm. (F) Sphere formation capacity of KM12C with the addition of increasing doses of rhGal-1; quantitative results (top panel) and representative images (bottom panel) are shown; scale bar, 30 μm. (G) Drug resistance capacity of KM12C to cisplatin (25 µM) after pretreatment with increasing dosages of rhGal-1 for 24 hours. Cell viability was assessed 48 hours after drug treatment. (H) Left panel: Validation of Gal-1 knockdown using small interfering RNA (siRNA) specific for Gal-1 (siRNA-I & siRNA-II) in WS1 fibroblasts. Non-target siRNA was used as a negative control. After 48 hours, CM from siRNA-I, siRNA-II, and siC were removed and analyzed by ELISA. Right panel: Invasion capacity of KM12C after culturing in siGal-WS1-CM compared to siC-WS1-CM for 48 hours. (I) Sphere formation capacity of KM12C cultured in KM12C-CM, siC-WS1-CM, or siGal-WS1-CM for 72 hours; quantitative results (top panel) and representative images (bottom panel) are shown; scale bar, 30 μm. (J) Drug resistance capacity of KM12C to cisplatin (25 µM) after pretreatment with KM12C-CM, siGal-WS1-CM, or siC-WS1-CM for 24 hours. Cell viability was assessed 48 hours after drug treatment; control, KM12C without cisplatin treatment. All results are shown as the mean ± SEM of three independent experiments. * p < 0.05; ** p < 0.01, and *** p < 0.005 compared to the control.

Article Snippet: Briefly, mouse monoclonal anti-Gal-1 antibody (1:500; Cat. No.437400; Invitrogen) was coated in 96-well plates at 4°C overnight.

Techniques: Expressing, Western Blot, Recombinant, Positive Control, Enzyme-linked Immunosorbent Assay, Staining, Fluorescence, Small Interfering RNA, Negative Control, Cell Culture

Journal: Frontiers in Oncology

Article Title: Stromal Galectin-1 Promotes Colorectal Cancer Cancer-Initiating Cell Features and Disease Dissemination Through SOX9 and β-Catenin: Development of Niche-Based Biomarkers

doi: 10.3389/fonc.2021.716055

Figure Lengend Snippet: Fibroblast-secreted Gal-1 significantly increases metastasis and tumor dissemination of CRC cells in vivo . (A) Body weight of NOD-SCID mice 40 days after tail vein injection of KM12C only (3 x 10 5 cells); KM12C (3 x 10 5 cells) admixed with WS1 silenced for with short-hairpin RNA (shRNA) of non-target sequences (shC-WS1; 3 x 10 5 cells); KM12C (3 x 10 5 cells) admixed with WS1 silenced with shRNA specific for Gal-1 (shGal-WS1; 3 x 10 5 cells); or shC-WS1 only (3 x 10 5 cells). Each condition consisted of three mice, with their body weight measured every 7 days. Immunohistochemistry (IHC) staining for human histone H1 (brown nuclei) in (B) mouse lung and (C) spleen tissue sections; representative sections (top panel) and quantitative results (bottom panel) are shown, with arrows indicating human Histone H1(+) cells; scale bar, 20 μm. (D) Visualization of fluorescently labeled co-cultured cells KM12C (3 x 10 5 cells; green fluorescence, labeled with DiO), and siC- or siGal-WS1 (3 x 10 5 cells; red fluorescence, labeled with with DiI) in lung sections 24 hours after injection into the tail vein of C57BL/6 mice. Top panel, representative images; bottom panel; quantitative results. Arrows indicate KM12C; scale bar, 100 μm. All results are shown as the mean ± SEM of three independent experiments. * p < 0.05, and *** p < 0.005 compared to the control. (E) Analyses of Gal-1 ( LGALS1 ) and β-catenin ( CTNNB1 ) expression with regard to disease recurrence in the public dataset GSE33113 and GSE17536 of gene expression omnibus (GEO); * p < 0.05; N.S., not significant.

Article Snippet: Briefly, mouse monoclonal anti-Gal-1 antibody (1:500; Cat. No.437400; Invitrogen) was coated in 96-well plates at 4°C overnight.

Techniques: In Vivo, Injection, shRNA, Immunohistochemistry, Labeling, Cell Culture, Fluorescence, Expressing

Journal: Frontiers in Oncology

Article Title: Stromal Galectin-1 Promotes Colorectal Cancer Cancer-Initiating Cell Features and Disease Dissemination Through SOX9 and β-Catenin: Development of Niche-Based Biomarkers

doi: 10.3389/fonc.2021.716055

Figure Lengend Snippet: Gal-1 promotes β-catenin expression, nuclear translocation, and activity in CRC cells. (A) IF staining for β-catenin (green fluorescence) in KM12C with the addition of increasing doses of rhGal-1 for 48 hours. Nuclei were stained with Hoechst 33342 (blue fluorescence). Arrows show nuclear β-catenin; scale bar, 10 μm. (B) Western blot for β-catenin levels in whole cell lysate (top panel) and nuclear fraction (bottom panel) of KM12C with the addition of increasing doses of rhGal-1 for 48 hours; for nuclear fraction, histone H1 is used as the positive control and α-Tubulin as the negative control. (C) Luciferase reporter assay for β-catenin activity in KM12C with the addition of increasing doses of rhGal-1. TOPFlash plasmids (β-catenin promoter reporter construct containing TCF/LEF binding sites; please see Materials and Methods) and TOPFlash mutant plasmids (β-catenin promoter reporter construct containing mutated TCF/LEF binding sites; please see Materials and Methods) were transduced into KM12C, with the luciferase activity measured 48 hours later; addition of the Wnt/β-catenin agonist CHIR-99021 (CHIR; 0.3 µM) was used as a positive control. (D) qPCR analysis for the gene expression of Twist1 in KM12C after treatment with rhGal-1 (100 ng/ml) and without or with the Wnt/β-catenin antagonist XAV-939 (XAV; 10 µM) for 24 hours. All results are shown as the mean ± SEM of three independent experiments. * p < 0.05; ** p < 0.01, and *** p < 0.005 compared to the control.

Article Snippet: Briefly, mouse monoclonal anti-Gal-1 antibody (1:500; Cat. No.437400; Invitrogen) was coated in 96-well plates at 4°C overnight.

Techniques: Expressing, Translocation Assay, Activity Assay, Staining, Fluorescence, Western Blot, Positive Control, Negative Control, Luciferase, Reporter Assay, Construct, Binding Assay, Mutagenesis

Journal: Frontiers in Oncology

Article Title: Stromal Galectin-1 Promotes Colorectal Cancer Cancer-Initiating Cell Features and Disease Dissemination Through SOX9 and β-Catenin: Development of Niche-Based Biomarkers

doi: 10.3389/fonc.2021.716055

Figure Lengend Snippet: SOX9 is a critical mediator involved in Gal-1-induced upregulation of β-catenin activity and CIC features. (A) Ingenuity Pathway Analysis (IPA) for the prediction of candidate mediators within the LGALS1/CTNNB1/Twist1 axis. IPA database revealed the several major pathways which might be involved in tumor development and metastasis. According to the IPA results and literature review, SOX9 was selected and confirmed whether it is the downstream gene of Gal-1 by Western blot. (B) Western blot for the analysis of SOX9 protein levels in KM12C after culturing in MRC-5- or WS1-CM; KM12C-CM was used as the control. Internal control: GAPDH. (C) Western blot for SOX9 levels in whole cell lysate (top panel) and nuclear fraction (bottom panel) of KM12C with addition of increasing doses of rhGal-1 for 48 hours; for nuclear protein blot, histone H1 is used as the positive control and α-Tubulin as the negative control. (D) Sphere formation capacity of shC-KM and shSOX9-II-KMC12 (shSOX9-KM) after treating with rhGal-1 (100 ng/ml) for 72 hours. (E) Drug resistance capacity of shC- and shSOX9-KM to cisplatin (25 µM) after pretreatment with rhGal-1 (100 ng/ml) for 24 hours. Cell viability was assessed 48 hours after drug treatment. (F) qPCR analysis for the gene expression of Twist1 in shC- and shSOX9-KM after treatment with Gal-1 (100 ng/ml) and XAV (10 µM). (G) Invasion capacity of shC- and shSOX9-KM with addition of rhGal-1 (100 ng/ml) and XAV (10 µM). All results are shown as the mean ± SEM of three independent experiments. * p < 0.05; ** p < 0.01, and *** p < 0.005 compared to the control. N.S., not significant.

Article Snippet: Briefly, mouse monoclonal anti-Gal-1 antibody (1:500; Cat. No.437400; Invitrogen) was coated in 96-well plates at 4°C overnight.

Techniques: Activity Assay, Western Blot, Positive Control, Negative Control, Expressing

Journal: Frontiers in Oncology

Article Title: Stromal Galectin-1 Promotes Colorectal Cancer Cancer-Initiating Cell Features and Disease Dissemination Through SOX9 and β-Catenin: Development of Niche-Based Biomarkers

doi: 10.3389/fonc.2021.716055

Figure Lengend Snippet: High expression of Gal-1 and SOX9 correlate with clinical CRC outcome. (A) ONCOMINE assessment of the expression levels of LGALS1 and SOX9 in the Kaiser Colon database. (B) Analysis of LGALS1 or SOX9 expression levels in tumor tissue compared to adjacent normal tissue using GSE9348 (top panel) and The Cancer Genome Atlas (TCGA) databases (bottom panel). * p < 0.05 and *** p < 0.005 for early-stage lesions compared to adjacent normal tissue. (C) Analysis of LGALS1 and SOX9 expression levels to the CRC stage using the GSE17536 and TCGA datasets. (D) Immunohistological staining of Gal-1 and SOX9 on CRC tumor samples, which included 40 primary lesions (primary), 10 metastatic lesions (metastatic), and 9 normal colon samples; scale bar, 100 μm. (E) Kaplan-Meier survival curves of four groups of CRC patients as stratified by median expression levels of SOX9 and Gal-1 in tumor tissue: SOX9 low /Gal-1 low , n = 38; SOX9 low /Gal-1 high & SOX9 high /Gal-1 low , n = 100; and SOX9 high /Gal-1 high , n = 39. Survival analyses was performed for two groups: SOX9 high /Gal-1 high versus SOX9 low /Gal-1 low (left-side graph); or for three groups: SOX9 high /Gal-1 high versus SOX9 high /Gal-1 low + SOX9 low /Gal-1 high versus SOX9 low /Gal-1 low (right-side graph).

Article Snippet: Briefly, mouse monoclonal anti-Gal-1 antibody (1:500; Cat. No.437400; Invitrogen) was coated in 96-well plates at 4°C overnight.

Techniques: Expressing, Staining

Journal: Frontiers in Oncology

Article Title: Stromal Galectin-1 Promotes Colorectal Cancer Cancer-Initiating Cell Features and Disease Dissemination Through SOX9 and β-Catenin: Development of Niche-Based Biomarkers

doi: 10.3389/fonc.2021.716055

Figure Lengend Snippet: Direct targeting of stromal-secreted Gal-1 on CRC cells promote CIC features and disease progression through SOX9 and β-catenin.

Article Snippet: Briefly, mouse monoclonal anti-Gal-1 antibody (1:500; Cat. No.437400; Invitrogen) was coated in 96-well plates at 4°C overnight.

Techniques:

Journal: Haematologica

Article Title: Impact of Sox11 over-expression in Ba/F3 cells

doi: 10.3324/haematol.2018.197467

Figure Lengend Snippet: Phenotypical, proliferative and transcriptional changes in Ba/F3 cells upon 72 h of induced Sox11 expression. (A) Western Blot of SOX11 protein expression in Sox11-ON (doxycycline supplemented medium) and Sox11-OFF (control medium) cells at 72 h, detected with the rabbit polyclonal anti-SOX11 antibody HPA000536, Sigma-Aldrich. B) Bright field microscopy images of cell aggregates following 72 h of continuous Sox11 expression (10x), imaged by Nikon Ti-E microscope. C) Sox11-ON cells incorporates less 3H-Thymidine at 72 h of Sox11 induction following a 4 h pulse, as compared to Sox11-OFF cells, measured in counts per minute, error bars represent the standard deviation (P=0.0086, n=3). D) Mean relative absorption measured by XTT (n=3). Metabolic activity is significantly reduced (P=0.0124) in Sox11-ON cells as compared to Sox11-OFF cells. E) Volcano plot representation of transcript level differences by Affymetrix MTA-1 mouse arrays (Microarray data has been made available through the GEO database with accession number GSE108419). Names are shown for the genes with the largest transcript level fold change (log2FC ≥1.3 or ≤−1.3). Blue and red: genes with significantly altered transcript levels in Sox11-ON cells and a fold change below -2 (blue) (FDR q-value ≤0.05 and log2FC ≥−1) or above 2 (red) (FDR q-value ≤0.05 and log2FC ≥1); gray: genes significantly changed at the transcript level (FDR q-value ≤0.05); black: genes with non-significant transcript level changes. F) Expression levels after Sox11 induction in genes specifically expressed at different stages of B-cell development. Only the pro-B restricted genes Id1 and Tal1 had significantly altered transcript levels in Sox11-ON cells (FDR q-value: 0.006 and 0.016, respectively). None of the other investigated pro-B and pre-B cell associated genes were altered at the transcript level. Genes associated with later B-cell developmental stages are shown for comparison. Transcript levels are presented as a gene-wise standardized expression (Z-score). FC: fold change.

Article Snippet: E) Volcano plot representation of transcript level differences by Affymetrix MTA-1 mouse arrays (Microarray data has been made available through the GEO database with accession number GSE108419).

Techniques: Expressing, Western Blot, Microscopy, Standard Deviation, Activity Assay, Microarray

Journal: Bioscience Reports

Article Title: Targeting intra-viral conserved nucleocapsid (N) proteins as novel vaccines against SARS-CoVs

doi: 10.1042/BSR20211491

Figure Lengend Snippet: ( A ) N-protein alignment from 4 different Coronaviruses (CoVs): 1. Severe acute respiratory syndrome coronavirus type 2 (SARS-CoV-2); 2. Severe acute respiratory syndrome coronavirus (SARS-CoV); 3. BAT severe acute respiratory (BAT SARS); 4. BAT coronavirus (BAT-CoV). Yellow color indicates the similarity of sequences among four viruses. The location of Peptide #1, #2, #3 (30 amino acid sequences) is also mentioned. ( B–E ) The whole N-protein vaccination was repeated four times (2-week interval). Red arrow indicates the time points for vaccination. Blood samples were taken before vaccination followed by every 2 weeks until 22nd week. Serum antibodies were detected by using anti-IgM, -IgG1, -IgG2 and anti IgG (H+L) horseradish peroxidase (HRP) conjugated antibodies. Antibody responses can be detected after 2nd vaccination and sustained till last sample collection in mouse#1 (B), #2 (C), #3 (D) and #4 (E). ( F ) Mean data of antibody productions in the BALB/c mice ( n =4). ( G ) Mean antibody production of N-protein vaccination in FVB mice ( n =3). Data represent mean ± S.D.

Article Snippet: Anti N-protein IgG (whole IgG) were detected by goat anti-mouse IgG-HRP (H+L) secondary antibody (Invitrogen 31430).

Techniques:

Journal: Bioscience Reports

Article Title: Targeting intra-viral conserved nucleocapsid (N) proteins as novel vaccines against SARS-CoVs

doi: 10.1042/BSR20211491

Figure Lengend Snippet: ( A ) Peptide sequences were selected based on N-protein conserved regions highlighted in yellow ( A). ( B ) Binding of anti N-polyclonal Abs serum and peptides were tested by ELISA. Whole N-protein was used as control. Peptides, #1, #2, #3 and N-protein were coated respectively with 5 ng and 20 ng/well. Anti-N polyclonal Abs serum (from A mouse at 1:1000 and 1:2000 dilutions) was incubated in each well followed by washing, and incubation with secondary anti-mouse IgG (H+L) (HRP). The optical density (OD) was measured. Anti-N polyclonal Abs bind not only whole N-protein but also enriched binding to Peptide #3, the highest OD compared with Peptide #1 and #2. ( C ) BALB/c mice were immunized with Peptide#3 in 2-week interval, 3 repeats. Red arrow indicates each vaccine time point. Antibody subtype in Anti-Peptide #3 Ab serum were classified by using anti-IgM, -IgG1, -IgG2a and -IgG (H+L) horseradish peroxidase (HRP) conjugated antibodies. Data represents mean ± S. D, n =3. ( D ) Comparison osf antibody subtype induction in N-protein vaccine and Peptide #3 vaccine after vaccination for three times. ( E ) Anti-Peptide #3 Ab serum (from C) were tested by Elisa for the binding capacity. Anti-Peptide #3 Ab serum binds to Peptide #3 and whole N-protein, detected by anti-mouse IgG (H+L) (HRP).

Article Snippet: Anti N-protein IgG (whole IgG) were detected by goat anti-mouse IgG-HRP (H+L) secondary antibody (Invitrogen 31430).

Techniques: Binding Assay, Enzyme-linked Immunosorbent Assay, Incubation

Journal: Bioscience Reports

Article Title: Targeting intra-viral conserved nucleocapsid (N) proteins as novel vaccines against SARS-CoVs

doi: 10.1042/BSR20211491

Figure Lengend Snippet: ELISA was done to analyze the binding affinity of peptides and N-protein (SARS-CoV2) to in house produced mouse anti SARS-CoV Ab (clone 6H3) . ELISA plate was coated with 5 ng and 20 ng/ well of different peptides and N-protein (SARS-CoV2). Mouse 6H3 antibodies were diluted at 1:1000 and 1:5000. The binding of antibody was detected by anti-mouse IgG (H+L) (HRP). The optical density (OD) was measured.

Article Snippet: Anti N-protein IgG (whole IgG) were detected by goat anti-mouse IgG-HRP (H+L) secondary antibody (Invitrogen 31430).

Techniques: Enzyme-linked Immunosorbent Assay, Binding Assay, Produced

Journal: Clinical science (London, England : 1979)

Article Title: Soluble (Pro)Renin Receptor Induces Endothelial Dysfunction and Hypertension in Mice with Diet-Induced Obesity via Activation of Angiotensin II Type 1 Receptor

doi: 10.1042/CS20201047

Figure Lengend Snippet: (A) Effect of 10μM Los on protein levels of Ang II in the medium of HUVECs after 50nM sPRR-His treatment. (B) HUVECs were pretreated with 1nM, 10nM, 50nM sPRR-His or 10μM Los for 1h followed by exposure to 1μM Ang II-I125. A radioactive ligand competitive binding assay then was performed. (C) HUVECs were incubated with 35S-labeled sPRR (35S-sPRR) overnight after one-hour pretreatment with Los at different dosages. A radioactive ligand competitive binding assay then was performed. The radioactive counts per minute (CPM) were measured in each group. (D) In vitro protein-protein interactions between AT1R and sPRR-His were detected. The AT1R or sPRR-His was labeled with 35S-methionine during in vitro translation. The commercial sPRR-His or AT1R proteins and its respective antibodies were added to immunoprecipitate the 35S-labeled proteins. EV: empty vector control; Anti-PRR1: PRR antibody (Sigma); Anti-PRR2: antibody against mouse PRR AA 32–45; Anti-PRR3: antibody against mouse PRR AA 219–235. (E) In vitro protein-protein interactions between sPRR-His and 35S-AT1R or 35S-AT1R site-mutations were detected. The immunoprecipitation experiment with anti-PRR antibody following incubation of sPRR-His and 35S-AT1R or its mutants was performed. The quantitative analysis is shown in (F). S109A: 35S-AT1R site-mutation in Serine109; K199A: 35S-AT1R site-mutation in Lysine199; N295A: 35S-AT1R site-mutation in Aspargine295. N=6–9. Statistical analysis was performed by using one-way ANOVA with the Bonferroni test for multiple comparisons or by using unpaired Student’s t test for two comparisons. ▲P < 0.01, compared with the Ang II-I125; *P < 0.01, compared with the CTR; #P < 0.01, compared with the 35S-sPRR; §P < 0.01, compared with the AT1R group. Data are mean ± SEM.

Article Snippet: The bound proteins to the unlabeled AT1 protein or sPRR-His protein were precipitated by incubating the mixture with 2μg of the rabbit anti AT1 antibody (Santa Cruz Biotechnology, Inc.) pelleted with protein G agarose (Roche), or by incubating with 2 μg of PRR antibody (Sigma) against mouse PRR 32–45 AA (Thermo fisher Com.), antibody against mouse PRR 219–235 AA (Thermo fisher Com.) and then pelleted with protein A agarose (Thermo fisher Com.).

Techniques: Competitive Binding Assay, Incubation, Labeling, In Vitro, Plasmid Preparation, Immunoprecipitation, Mutagenesis

Journal: The EMBO Journal

Article Title: PARG-deficient tumor cells have an increased dependence on EXO1/FEN1-mediated DNA repair

doi: 10.1038/s44318-024-00043-2

Figure Lengend Snippet: Reagents and tools.

Article Snippet: Mouse YUSA library reverse primer (Library amplification) , Integrated DNA Technologies (IDT) , GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTGAAAAGCGCCTCCCCTACC.

Techniques: Isolation, Recombinant, CRISPR, Knock-Out, Sequencing, Amplification, Transfection, Software, Fractionation

Journal: Journal of Experimental & Clinical Cancer Research : CR

Article Title: A novel bispecific antibody targeting CD3 and prolactin receptor (PRLR) against PRLR-expression breast cancer

doi: 10.1186/s13046-020-01564-4

Figure Lengend Snippet: PRLR-DbsAb stimulates T cell infiltration and the PD-L1 expression unregulated in tumor tissue. sc Tumor cells plus sc effector cells (E/T 1:4) model: ( a ) HE staining of tumor tissue strapped from mice treated with 3 mg/kg PRLR-DbsAb. The above image showed normal tumor tissue, and the following image showed degenerate necrotic tumor tissue; ( b ) Immunohistochemical staining of CD8 in tumor tissue from the mice of different group; ( c ) Immunohistochemical staining of PD-L1 in tumor tissue from the mice of different group. Sc tumor cells plus ip effector cells (1:1) model: ( d ) HE staining; ( e ) Immunofluorescent staining of CD8. Three independent experiments were conducted and representative data is shown in this figure

Article Snippet: Breast cancer cell lines (MDA-MB-231, MCF-7, SKBR-3, and T47D) were incubated with control isotype IgG, PE-conjugated mouse anti-Human PRLR (Sino Biological) or APC-conjugated mouse anti-Human PD-L1 (Sino Biological) on ice for 30 min and then washed twice with FACS buffer (PBS with 2% FBS).

Techniques: Expressing, Staining, Immunohistochemical staining

Journal: Journal of Experimental & Clinical Cancer Research : CR

Article Title: A novel bispecific antibody targeting CD3 and prolactin receptor (PRLR) against PRLR-expression breast cancer

doi: 10.1186/s13046-020-01564-4

Figure Lengend Snippet: PD-1 inhibition increases PRLR-DbsAb mediated cytotoxicity of PRLR expression target cell. FACS histograms of PDL1 expression on different breast cancer cell lines including MDA-MB-231 ( a ) and T47D ( e ). The gray histogram is the fluorescent signal of non-specific IgG control antibody. Freshly isolated PBMCs and the target cells of MDA-MB-231 ( b ) or T47D ( f ) were incubated with or without addition of PD-1 mAb in different concentrations of PRLR-DbsAb at the ratio of 10:1 (E: T) for 20 hours. MDA-MB-231 ( c ) and T47D ( g ) cells were treated with 100 ng/ml PRLR-DbsAb at different time points (3, 10 and 20h) with or without adding PD-1 mAb and LDH release was detected. The expression of PD-L1 ( d and h ) on the corresponding effector cells and target cells is measured by Flow cytometer, respectively. ( i ) FACS histogram of the PD-L1 expression of target T47D with or without addition of 100 ng/ml PRLR mAb. ( j ) PD-L1 expression on CD4+ and CD8+ T cells. PBMCs and target T47D cells were incubated with 100 ng/ml PRLR-DbsAb at the ratio of 10:1 (E: T) for 20 hours. Three independent experiments were performed and the data was represented as the Mean ±SEM. *, ** and *** respectively indicate a statistically significant difference of at least P <0.05, <0.01 and <0.001

Article Snippet: Breast cancer cell lines (MDA-MB-231, MCF-7, SKBR-3, and T47D) were incubated with control isotype IgG, PE-conjugated mouse anti-Human PRLR (Sino Biological) or APC-conjugated mouse anti-Human PD-L1 (Sino Biological) on ice for 30 min and then washed twice with FACS buffer (PBS with 2% FBS).

Techniques: Inhibition, Expressing, Isolation, Incubation, Flow Cytometry

Journal: Journal of the American Heart Association: Cardiovascular and Cerebrovascular Disease

Article Title: Reduced Plasma Kallistatin Is Associated With the Severity of Coronary Artery Disease, and Kallistatin Treatment Attenuates Atherosclerotic Plaque Formation in Mice

doi: 10.1161/JAHA.118.009562

Figure Lengend Snippet: Clinical and Biochemical Characteristics of Participants

Article Snippet: Cryosections 7 μm thick were subjected to immunohistochemical analysis to detect the presence of the endogenous mouse kallistatin (Sino Biological, Beijing, China).

Techniques:

Journal: Journal of the American Heart Association: Cardiovascular and Cerebrovascular Disease

Article Title: Reduced Plasma Kallistatin Is Associated With the Severity of Coronary Artery Disease, and Kallistatin Treatment Attenuates Atherosclerotic Plaque Formation in Mice

doi: 10.1161/JAHA.118.009562

Figure Lengend Snippet: Kallistatin levels in the study groups. A , Dispersion graph of plasma kallistatin levels in patients classified according to the number of diseased vessels. There was a statistically significant difference among patients categorized by the number of diseased vessels ( & P <0.001, Control vs 1‐vessel, 2‐vessel, or 3‐vessel disease; * P =0.006, 1‐vessel disease vs 2‐vessel disease; ∆ P <0.001, 1‐vessel disease vs 3‐vessel disease; # P =0.015, 2‐vessel disease vs 3‐vessel disease). B , A strong negative correlation between plasma kallistatin levels and Gensini score was observed in all patients (n=456, r=−0.346, P <0.001). C , There was a strong negative correlation between plasma kallistatin levels and MDA levels in all patients (n=456, r=−0.572, P <0.001). MDA indicates malondialdehyde.

Article Snippet: Cryosections 7 μm thick were subjected to immunohistochemical analysis to detect the presence of the endogenous mouse kallistatin (Sino Biological, Beijing, China).

Techniques:

Journal: Journal of the American Heart Association: Cardiovascular and Cerebrovascular Disease

Article Title: Reduced Plasma Kallistatin Is Associated With the Severity of Coronary Artery Disease, and Kallistatin Treatment Attenuates Atherosclerotic Plaque Formation in Mice

doi: 10.1161/JAHA.118.009562

Figure Lengend Snippet: Logistic Regression Analysis of Variables

Article Snippet: Cryosections 7 μm thick were subjected to immunohistochemical analysis to detect the presence of the endogenous mouse kallistatin (Sino Biological, Beijing, China).

Techniques:

Journal: Journal of the American Heart Association: Cardiovascular and Cerebrovascular Disease

Article Title: Reduced Plasma Kallistatin Is Associated With the Severity of Coronary Artery Disease, and Kallistatin Treatment Attenuates Atherosclerotic Plaque Formation in Mice

doi: 10.1161/JAHA.118.009562

Figure Lengend Snippet: Kallistatin inhibited low‐shear stress–induced carotid artery plaque formation. A , Representative magnetic resonance images in cross‐sectional views through the carotid arteries. The red arrow indicates the cross section of the left carotid artery, and the blue arrow indicates the cross section of the right carotid artery. B , Quantitative analysis of left carotid artery diameter in the Ad. HKS and Ad.Null groups. L‐ NAME and NAM blocked the effects of kallistatin (n=10, * P <0.05 vs the Ad.Null‐, L‐ NAME ‐, or NAM ‐treated groups). C , Quantitative analysis of left carotid artery plaque volume in the Ad. HKS and Ad.Null groups. L‐ NAME and NAM blocked the effect of kallistatin; n=10 (* P <0.05 vs the Ad.Null‐, L‐ NAME ‐ or NAM ‐treated groups). D , Plasma MDA levels in apoE −/− mice. E , Plasma TNF ‐α levels in apoE −/− mice. F , Distribution of mouse kallistatin expression in atherosclerotic lesions and normal vascular tissue. Data are presented as the mean± SEM ; n=10, * P <0.05 vs the Ad.Null‐, L‐ NAME ‐, or NAM ‐treated groups. Ad.HKS indicates adenovirus containing kallistatin cDNA; Ad.Null, adenovirus containing null cDNA; L‐NAME, N ω ‐nitro‐L‐arginine methyl ester; MDA, malondialdehyde; NAM, nicotinamide; SEM, standard error of the mean; TNF‐α, tumor necrosis factor‐α.

Article Snippet: Cryosections 7 μm thick were subjected to immunohistochemical analysis to detect the presence of the endogenous mouse kallistatin (Sino Biological, Beijing, China).

Techniques: Expressing

Journal: Journal of the American Heart Association: Cardiovascular and Cerebrovascular Disease

Article Title: Reduced Plasma Kallistatin Is Associated With the Severity of Coronary Artery Disease, and Kallistatin Treatment Attenuates Atherosclerotic Plaque Formation in Mice

doi: 10.1161/JAHA.118.009562

Figure Lengend Snippet: Kallistatin led to morphological changes in the atherosclerotic plaques of apoE −/− mice. A , Representative images of HE staining. Original magnification is ×10 (n=5 in each group). B , Oil red O staining of carotid specimens of mice in the Ad.Null group, the Ad. HKS group, and L‐ NAME ‐ or NAM ‐treated groups (n=5 in each group). C , Representative images of superoxide formation labeled by the red fluorescence dye dihydroethidium in the carotid artery of Ad.Null mice, Ad. HKS mice, Ad. HKS +L‐ NAME mice, and Ad. HKS + NAM mice (n=5 in each group). D , Representative images of CD 68 immunostaining in lesion areas of the left carotid artery (n=5 in each group). E , Immunohistochemical assessments of the protein level of TNF ‐α in carotid plaque (n=5 in each group). F, Quantitative analyses of CD 68‐positive cells in the 4 groups (n=5 in each group, * P <0.05 vs the Ad.Null‐, L‐ NAME ‐, or NAM ‐treated groups). G , Fluorescence intensity was measured by a fluorescence microscope and quantified with Image software (n=5 in each group, * P <0.05 vs the Ad.Null‐, L‐ NAME ‐, or NAM ‐treated groups). H , Colocalization of PE red fluorescence ( SIRT 1) and FITC green fluorescence ( CD 31) within plaques (×40 magnification) in the carotid arteries of the Ad.Null, Ad. HKS , Ad. HKS +L‐ NAME , and Ad. HKS + NAM groups with labeled cell nuclei (blue) (n=5 in each group). Regions shown at a higher magnification (far right) are indicated by yellow boxes. Endothelial cell‐specific SIRT 1 fluorescence was measured on the luminal side of the internal elastic lamina only and expressed in mean pixel intensity per area (n=5 in each group, # P <0.05 vs the Ad.Null‐ and NAM ‐treated groups). I , Colocalization of PE red fluorescence ( eNOS ) and FITC green fluorescence ( CD 31) within carotid artery plaques (×40 magnification) of the 4 groups with labeled cell nuclei (blue). Regions shown at a higher magnification (far right) are indicated by yellow boxes. Endothelial cell‐specific eNOS fluorescence was measured on the luminal side of the internal elastic lamina only and expressed in mean pixel intensity per area (* P <0.05 vs the Ad.Null‐, L‐ NAME ‐, or NAM ‐treated groups). We observed that red fluorescence ( SIRT 1, eNOS ) and green fluorescence ( CD 31) signals were colocalized in the Ad. HKS group. Scale bar=50 μm. Ad.HKS indicates adenovirus containing kallistatin cDNA; Ad.Null, adenovirus containing null cDNA; DAPI, 4′,6‐diamidino‐2‐phenylindole; DHE, dihydroethidium; eNOS, endothelial nitric oxide synthase; FITC, fluoroisothiocyanate; HE, hematoxylin and eosin; L‐NAME, N ω ‐nitro‐L‐arginine methyl ester; NAM, nicotinamide; PE, phycoerythrin; SIRT1, sirtuin 1; TNF‐α, tumor necrosis factor‐α.

Article Snippet: Cryosections 7 μm thick were subjected to immunohistochemical analysis to detect the presence of the endogenous mouse kallistatin (Sino Biological, Beijing, China).

Techniques: Staining, Labeling, Fluorescence, Immunostaining, Immunohistochemical staining, Microscopy, Software

Journal: Journal of the American Heart Association: Cardiovascular and Cerebrovascular Disease

Article Title: Reduced Plasma Kallistatin Is Associated With the Severity of Coronary Artery Disease, and Kallistatin Treatment Attenuates Atherosclerotic Plaque Formation in Mice

doi: 10.1161/JAHA.118.009562

Figure Lengend Snippet: Effect of kallistatin on eNOS (A), SIRT 1 (B), IL ‐10 (C), SOD 2 (D), and catalase (E) expression in low‐shear stress–induced carotid artery plaques in vivo (n=5 in each group, * P <0.05 vs the Ad.Null‐, L‐ NAME ‐, or NAM ‐treated groups. # P <0.05 vs the Ad.Null‐ and NAM ‐treated groups). Ad.HKS indicates adenovirus containing kallistatin cDNA; Ad.Null, adenovirus containing null cDNA; eNOS, endothelial nitric oxide synthase; IL, interleukin; L‐NAME, N ω ‐nitro‐L‐arginine methyl ester; NAM, nicotinamide; SIRT1, sirtuin 1; SOD2, superoxide dismutase 2.

Article Snippet: Cryosections 7 μm thick were subjected to immunohistochemical analysis to detect the presence of the endogenous mouse kallistatin (Sino Biological, Beijing, China).

Techniques: Expressing, In Vivo

Journal: Journal of the American Heart Association: Cardiovascular and Cerebrovascular Disease

Article Title: Reduced Plasma Kallistatin Is Associated With the Severity of Coronary Artery Disease, and Kallistatin Treatment Attenuates Atherosclerotic Plaque Formation in Mice

doi: 10.1161/JAHA.118.009562

Figure Lengend Snippet: Effect of kallistatin protein ( KS ) on TNF ‐α–induced HUVEC s. NADPH oxidase activity ( A ), intracellular ROS accumulation ( B ), relative SIRT 1 mRNA expression levels ( C ), relative eNOS mRNA expression levels ( D ), and SIRT 1 and eNOS protein expression ( E ). Data are presented as the mean± SEM (n=5, * P <0.05 vs the TNF ‐α, TNF ‐α+ KS + NAM , and TNF ‐α+ KS + L‐ NAME groups. # P <0.05 vs the TNF ‐α and TNF ‐α+ KS + NAM groups). eNOS indicates endothelial nitric oxide synthase; HUVEC, human umbilical vein endothelial cells; KS, kallistatin; L‐NAME, N ω ‐nitro‐L‐arginine methyl ester; NAM, nicotinamide; ROS, reactive oxygen species; SIRT1, sirtuin 1; TNF‐α, tumor necrosis factor‐α.

Article Snippet: Cryosections 7 μm thick were subjected to immunohistochemical analysis to detect the presence of the endogenous mouse kallistatin (Sino Biological, Beijing, China).

Techniques: Activity Assay, Expressing